T3 RNA Polymerase (20 U/μL) (Thermo Scientific™)

Thermo Scientific Bacteriophage T3 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter and is able to incorporate modified nucleotide.

Highlights

• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

• Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Note

Consensus promoter sequence:
T3: AATTAACCCTCACTAAAGGGAGA
The position in bold (+1) indicates the first nucleotide incorporated into RNA during transcription. Only bases at this position through +3 are critical for transcription, and they must be a G and a purine base, respectively.